![]() ![]() Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.I'm trying to parse through a csv file and extract the data from only specific columns.Įxample csv: ID | Name | Address | City | State | Zip | Phone | OPEID | IPEDS |ġ0 | C. ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC ![]() LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG #SampleID = code including researcher initials and sequential run number ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. Rarified illumina dataset for each ITS Region Wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_dev Wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. Wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_dev Wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. ![]() Resulting OTU Table and OTU table with taxonomy ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. Great_lakes_Map_coordinates.xlsx = coordinates of sample sites All decimal latitude and decimal longitude coordinates of our collecting sites are also included. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. ![]() 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |